NarI from New England Biolabs

Product Specs
ItemNarI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0191S
Quantity500 units
Concentration2-5 u/µL
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

GG/CGCC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Pioneer activity distinguishes activating from non‐activating SOX2 binding sitesThe EMBO JournalOctober 16, 2023Michela Maresca, Teun van den Brand, Hangpeng Li, Hans Teunissen, James Davies, Elzo de Witsupplemented with dNTPs (dATP, dCTP, dGTP and dTTP; 400 μM final concentration of each (Thermo Fischer R0191)); EGTA 5 mM; T4 Polynucleotide kinase PNK 200 U/ml (NEB M0201L); DNA Polymerase I Large (Klenow) Fragment

(2) Optimized genetic code expansion technology for time‐dependent induction of adhesion GPCR‐ligand engagementProtein ScienceApril 1, 2023Marcel Streit, Mareike Hemberger, Stephanie Häfner, Felix Knote, Tobias Langenhan, Gerti Beliuassembled, consisting of 50 μl Q5 HF Buffer (New England Biolabs #B9027), 5 μl of dNTPs (Thermo Scientific #R0191) with a concentration of 25 mM, 100 ng of the template DNA diluted in ddH2O. Depending on CG‐content

(3) Inhibition of Crmp1 Phosphorylation at Ser522 Ameliorates Motor Function and Neuronal Pathology in Amyotrophic Lateral Sclerosis Model MiceeneuroMay 6, 2022Tetsuya Asano et al.mixed with standard PCR reagents. To distinguish each genotype, PCR products were digested with NarI (#R0191; New England BioLabs) and visualized by electrophoresis on 2% agarose (Extended Data Fig. 2-1B). Sanger sequencing

(4) SETDB1 fuels the lung cancer phenotype by modulating epigenome, 3D genome organization and chromatin mechanical propertiesNucleic acids researchMay 6, 2022Zakharova VV, Magnitov MD, Del Maestro L, Ulianov SV, Glentis A, Uyanik B, Williart A, Karpukhina A, Demidov O, Joliot V, et al.MQ water, 14 μl of 10× T4 DNA ligase reaction buffer, 3.5 μl of 10 mM dNTP mix (Thermo Fisher; Cat#: R0191), 5 μl of 3 U/μl T4 DNA polymerase, 5 μl of 10 U/μl T4 polynucleotide kinase (NEB; Cat#: M0201L), 1

(5) Mre11-Rad50 oligomerization promotes DNA double-strand break repairNature communicationsMay 2, 2022Kissling VM, Reginato G, Bianco E, Kasaciunaite K, Tilma J, Cereghetti G, Schindler N, Lee SS, Guérois R, Luke B, et al.Tris-HCl (pH 8.8), 160 mM (NH4)2SO4, 50% glycerol, 0.1% Tween-20), 4 µl 2 mM dNTP mix (ThermoFisher, R0191), 0.3 µl 10 µM forward oligonucleotide (1L oBL358, 6Y′ oBL361, or 6R oBL360), 0.3 µl 10 µM reverse oligonucleotide

(6) Reactivation of a developmentally silenced embryonic globin geneNature communicationsJuly 21, 2021King AJ, Songdej D, Downes DJ, Beagrie RA, Liu S, Buckley M, Hua P, Suciu MC, Marieke Oudelaar A, Hanssen LLP, et al.supplemented with dNTPs (final concentration 400 µM of each of dATP, dCTP, dGTP and dTTP (Thermo Fischer R0191)) and EGTA 5 mM. T4 Polynucleotide kinase PNK (NEB M0201L) and DNA Polymerase I Large (Klenow) Fragment

(7) Glioblastomas acquire myeloid-affiliated transcriptional programs via epigenetic immunoediting to elicit immune evasionCellApril 29, 2021Gangoso E, Southgate B, Bradley L, Rus S, Galvez-Cancino F, McGivern N, Güç E, Kapourani CA, Byron A, Ferguson KM, et al.B,Life Technologies,Cat#: 10687010 DMSO,Sigma Aldrich,Cat#: 276855 dNTPs,Thermo Scientific,Cat#: R0191 LongAMP Taq Polymerase,NEB,Cat#: M0323 Paraformaldehyde Powder 95%,Sigma,Cat#: 158127 Triton X-100,Merck

(8) RollFISH achieves robust quantification of single-molecule RNA biomarkers in paraffin-embedded tumor tissue samplesCommunications BiologyDecember 1, 2018Chenglin Wu et al.polymerase (Thermo, cat. no. EP0091), 1 × phi29 polymerase buffer, 0.25 mM dNTPs (Thermo, cat. no. R0191), 0.2 μg/μl BSA (NEB cat. no. B9000S) and 5% glycerol in DEPC-H2O for 1 h or otherwise specified. Samples

(9) Random Insertional Mutagenesis of a Serotype 2 Dengue Virus CloneBIO-PROTOCOLAugust 20, 2018Jeffrey W. Perry, Andrew W. TaioligoCGGACTCAGCCTCTGTGCGTCCCTACTCTACC SacI (New England Biolabs, catalog number: R3156) NarI (New England Biolabs, catalog number: R0191) EcoRV (New England Biolabs, catalog number: R3195) XbaI (New England Biolabs, catalog number: R0145)

Be the First to Write a Review!

NarI

NarI from New England Biolabs

Sequence

New England Biolabs

Citations (9)

Reviews

NarI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map